Introduction

In vitro embryo production (IVP) is one of the most critical biotechnologies in animal breeding, in which several factors can influence the efficiency and contribute toward varying production quality in embryos, irrespective of whether they are produced in vivo or in vitro. Oxidative stress is an important factor (El-Aziz et al. 2016; Premkumar and Chaube 2016) that results from the generation of free radicals such as reactive oxygen species (ROS) produced due to cellular metabolism.

Honey is a sweet liquid composed of a complicated sugar mixture and a natural product made by Apis mellifera (honeybees) using nectar collected from plants and some bee secretions (Sowa et al. 2019). Honey also consists of small amounts of bioactive constituents, including minerals, enzymes, phenolic acids, vitamins, flavonoids, and organic acids (Sime et al. 2015), along with low concentrations of proteins that contribute to its pharmacological activities, including anti-inflammatory (Tonks et al. 2003; Yusof et al. 2007) and antimicrobial properties (Taormina et al. 2001; Gomes et al. 2010). Furthermore, honey contains vital biologically active molecules such as glutamine, taurine, cysteine, glutamic acid, and threonine (Paramás et al. 2006). Although there are variations in the climatic conditions in which honey is produced, the major ingredients in most of the types are similar but might differ in concentrations of the various components. Studies have verified, for example, that honey may act as a natural antioxidant (Gannabathula et al. 2017; Liu et al. 2019), which tends to vary with differences in flower arrangements and might significantly affect the antioxidant potential due to the differences in antioxidant enzymatic activities, such as those of peroxidase, catalase, and glucose oxidase, along with variations in the content of secondary plant metabolites such as flavonoids and phenols, also with high antioxidant properties (Escriche et al. 2014; Sadowska et al. 2019).

Bee pollen is a fine powder collected by bees from various plant species. It is transformed into a complex product by mixing with nectar and bee salivary secretions (Pawar et al. 2014). Bee pollen consists of major components, including proteins and amino acids, sugars, and lipids, as well as minor components, including vitamins, minerals, and flavonoid glycosides (Bogdanov 2004). Although biologically active ingredients of bee pollen are present in small quantities, they contribute to its beneficial properties (Guiné 2015). Bee pollen contains approximately 10.4% of essential amino acids, including threonine, phenylalanine, lysine, isoleucine, methionine, leucine, tryptophan, histidine and valine (Roulston and Cane 2000).

Oxidative stress arises due to the generation of ROS in in vitro culture (IVC) conditions, which leads to a reduction in embryonic development because of increased turnover of oocytes, thereby resulting in spontaneous damage to mitochondria and a subsequent reduction in adenosine triphosphate (ATP) synthesis, which in turn causes a decrease in the developmental competence of oocytes (Jagannathan et al. 2016; Khazaei and Aghaz 2017; Sasaki et al. 2019). The in vivo environment contains oxygen scavengers in the follicular and oviduct fluids to protect oocytes and embryos from oxidative stress (Duzguner et al. 2014). This is because the process of oocyte protection plays a critical role against the effects of ROS at the preimplantation embryonic developmental stage. The scavengers are antioxidants for ROS that help in maintaining a balance between oxidant/antioxidant in the oocytes.

Several researchers have tested the effects of antioxidant supplements such as l-carnitine (Dunning and Robker 2017), melatonin (Do et al. 2015), fenugreek seed extract (Barakat and Al-Himaidi 2013) and green tea extract (Barakat et al. 2014) through supplementation in the in vitro maturation medium for oocyte development of various mammalian species (Aghaz et al. 2015; Rodrigues-Cunha et al. 2016) and have indicated the importance of antioxidants and their concentrations in contributing to the improvement of the quality of embryos/oocytes in the in vitro culture system (Öztürkler et al. 2010). Previous research has demonstrated that addition of green tea leaf extract to the IVM medium at a concentration 0.3 mg/mL resulted in improvement of the maturation rate of sheep oocytes and embryo development (Barakat et al. 2014). In addition, Do et al. (2015) demonstrated that using melatonin at a concentration of 25 ng/mL as a supplement in the IVM culture medium enhanced the developmental competence of porcine embryos. Furthermore, other studies have confirmed that the addition of antioxidants such as taurine and hypotaurine toadied in maintaining the redox status in oocytes (Suzuki et al. 2007; Manjunatha et al. 2009; Premkumar and Chaube 2014).

Moreover, supplementing the IVM culture medium with superoxide dismutase, catalase, and peroxiredoxins has been reported to have beneficial effects on the development of preimplantation embryos in mice (Legge and Sellens 1991; Natsuyama et al. 1993), porcine (Ozawa et al. 2006), and bovine (Ali et al. 2003). Glutathione reductase is considered as one of the most important antioxidants that functions in regulating the balance of oxidation in cells and protects them from ROS toxicity (You et al. 2010). A previous study showed that addition of taurine to the in vitro maturation medium of buffalo oocytes improved the embryo production efficiency (Manjunatha et al. 2009). Another earlier study conducted to explore the effect of essential and nonessential amino acids on the in vitro development of bovine embryos demonstrated that the use of essential amino acids alone had a detrimental effect, whereas a combination of nonessential and essential amino acids promoted blastocyst hatching and formation (Liu and Foote 1995).

In recent years, there have been several uses of bee products in both traditional and modern medicine, which include honey, royal jelly, bee pollen, beebread, bee venom, and propolis (Molan 1999; Veshkini et al. 2018). Recent research has reported that the addition of Nigella sativa honey and honeybee pollen to the in vitro maturation medium of sheep oocytes increased both the maturation rate and gene expression and enhanced the GSH content (Barakat et al. 2020; Kaabi et al. 2020).

All bee products possess pharmacological properties because they are rich in active biological components and enzymes and can thus promote good health and prevent the development of some diseases due to their beneficial biological and functional properties (Biesalski et al. 2009; Pasupuleti et al. 2017).

In this study, we investigated the effect of honey obtained from two plant sources, Sider and N. sativa (black seed) and honeybee pollen on the maturation of oocytes. Moreover, we examined the changes in GSH content and effects on the expression of candidate genes associated with oocyte maturation and development using in vitro matured sheep oocytes as a model.

Materials and Methods

Experimental details and treatments

Chemicals and materials: All chemicals, media, dishes used for oocyte culture, and Millipore membrane filter syringes were obtained from Sigma-Aldrich (St. Louis, Missouri, U.S.A.) and Nunclon (Denmark) or Thermo Fisher, respectively, unless otherwise indicated.

Experimental design: We evaluated the effects of bee products during in vitro maturation on the maturation rate, GSH concentration, and expression of candidate genes. A preliminary study was initially conducted to evaluate the effects of N. sativa honey and Sider honey at 5% concentration with or without 1.0 μg/mL honeybee pollen. Excellent and good sheep oocytes were selected and divided into three groups according to the treatments to be applied as follows: Group 1: oocytes cultured in a defined maturation medium + 5% concentration of Sider (Group 1A) or N. sativa (Group 1 B) honey as controls; Group 2: oocytes cultured in a defined maturation medium + 5% Sider honey + 1.0 μg/mL honeybee pollen; and Group 3: oocytes cultured in a defined maturation medium + 5% N. sativa honey + 1.0 μg/mL honeybee pollen.

The defined maturation medium (without supplements) comprised tissue culture medium-199 with Earl’s (TCM-199) + 4.0 mg/mL bovine serum albumin (BSA) + 0.02 IU FSH/mL + 0.23 IU LH/mL + 1.0 μg/mL estradiol 17-β + 50 μg/mL streptomycin (Barakat et al. 2018). Oocytes in all experimental treatments were cultured for 22–24 h after treatments in a CO₂ incubator at 38.5°C with 5% CO₂ and high humidity (>90%). Each treatment was repeated three times on different days.

Experimental procedures

Oocyte collection: Najdi mature female sheep ovaries were collected from Riyadh slaughterhouses, Saudi Arabia, and transferred to the laboratory within 1–2 h in warmed physiological saline (35°C–37°C) supplemented with antibiotics. Oocytes were aspirated from visible follicles on the ovary surface (2–8 mm diameter) using 20 G needles attached to a 10 mL disposable syringe. Then, all oocytes having several layers of cumulus cells and homogeneous cytoplasm (healthy oocytes) were selected as described by Kharche and Birade (2013) for in vitro maturation (IVM) experiments.

In vitro maturation of oocytes: Selected oocytes were washed two to three times with the collection medium (TCM-199 + 50 μg/mL kanamycin + 0.5 mM sodium pyruvate + 50 μg/mL heparin + 4 mg/mL fatty-acid-free BSA) and washed three times with maturation medium. Then, the oocytes were cultured in their respective groups (Groups 1–3) in 35-mm Petri dishes; each group contained 15–20 cumulus oocyte complexes in droplets of IVM medium; each drop was ~100 µL of IVM medium overlaid with mineral oil and placed into 5% CO₂ incubator at least 2 h before culture.

Examination of oocyte nuclear maturation: After treatments and allowing for the elapse of the maturation period, hyaluronidase (100 I.U/mL) and a mechanical force-by-mouth procedure were used to gently pipette and clean the oocytes from cumulus cells and then fix them in acetic acid/ethanol (1:3) for 24–48 h. Next, denuded oocytes were stained with 1% aceto-orcein in 45% acetic acid (Prentice-Biensch et al. 2012). Oocyte nuclear division stages were divided into germinal vesicle breakdown (GVBD), germinal vesicle (GV), metaphase I (MI), anaphase (anaph.) and metaphase II (MII). Oocytes in the MII stage were recorded as mature oocytes.

GSH assay: The GSH concentration in matured oocytes was estimated according to the instruction provided in the GSH estimation kit (Sigma, Cat. CS0260) and the linear equation of the standard solution that accompanied the kit was applied.

Measurement of gene expression: Total RNA was prepared from each oocyte treatment group, and cDNA was synthesized in two steps according to the instructions of the manufacturer kits. RNA was isolated using the PureLink RNA Mini Kit (Cat.No.12183018A) and cDNA was prepared using the High-Capacity cDNA Reverse Transcription Kit (Cat.No.4368813) for real-time PCR. The candidate genes of interest were GDF-9, BAX, Cyclin B, C-MOS and IGF1. The sequences of specific primers used in the reverse transcription for the candidate genes are shown in Table 1 and the cycle conditions of RT-PCR are shown in Table 2.

The expression of each gene was measured using the comparative Ct (2^−ΔCCt) method (Livak and Schmittgen 2001), according to the following equations:

Δ Ct (treated) = Ct (target) − Ct (reference)

Δ Ct (non-treated) = Ct (target) − Ct (reference)

ΔΔ Ct = Δ Ct (treated) − Δ Ct (non-treated)

Gene Expression= 2^−ΔΔCt

Statistical analysis

All data were statistically analyzed using the SPSS program (v. 20.0, S.P.S.S. Inc., Chicago, I.L., U.S.A.). The preliminary experimental data were analyzed using a two-way analysis of variance (ANOVA) and the second experimental data were analyzed using one-way ANOVA. After the statistical analysis, the differences between mean values were performed by Duncan’s test, considering P ≤ 0.05 to be statistically significant. All results were expressed as mean ± SEM (standard error of the mean).

Results

Effect of supplementing maturation medium with bee pollen and black seed honey on in vitro maturation rate

As shown in Table 3, the maturation rate of sheep oocytes after the addition of bee pollen along with bee honey to the maturation medium was significantly better than that achieved using black seed honey alone, whereas when black seed honey was used, the mean maturation value of oocytes in the MII stage was 0.49 ± 0.04 compared to that observed with using black seed honey alone (0.40 ± 0.04). The same results were also found with the trait GV in both treatments and for the trait MI when using Sider honey alone or bee pollen with Sider honey (0.05 ± 0.02 or 0.14 ± 0.02). The opposite result was observed for the other traits, where the mean values in the treatment with black seed honey alone were significantly higher than those observed using the combination of black seed honey and bee pollen as medium supplements. Hence, it was inferred that the addition of bee pollen to black seed honey improved the maturation rate of sheep oocytes in vitro, as it significantly increased the mean value of the oocytes in the MII stage.

Effect of adding bee pollen along with honey to maturation medium on GSH content in in vitro matured Najdi sheep oocytes

Fig. 1: Effect of adding 1 μg/mL bee pollen + 5% black seed honey to the maturation medium on the mean concentration of glutathione (GSH) content in matured sheep oocytes

Fig. 2: Effect of supplementing maturation medium with either black seed honey combined with bee pollen or Sider honey combined with bee pollen on glutathione (GSH) content of matured Najdi sheep oocytes

As shown in Fig. 1, adding bee pollen along with black seed honey to the maturation medium significantly increased the concentration of GSH in matured oocytes compared to that observed with using black seed honey alone. In contrast, the addition of bee pollen to Sider honey did not improve the maturation rate. Therefore, adding bee pollen was beneficial when added in combination with black seed honey.

Effect of adding bee pollen along with black seed honey to maturation medium on the expression of candidate genes

The expression levels of the candidate genes are shown in Table 4, which indicate that the addition of bee pollen at 1 μg/mL concentration in the presence of black seed or Sider honey at 5% concentration to the maturation medium resulted in significantly increased mean expression levels of all the examined genes, except BAX gene (apoptotic gene), whose expression was significantly decreased with the combination of black seed honey and bee pollen IVM medium supplement and thus, improving that the expression of the genes responsible for the development and regulation of oocyte maturation, and by the same token repressed physiological programmed cell death (apoptosis).

Comparison of the effect of adding black seed honey combined with bee pollen and Sider honey along with bee pollen on in vitro maturation rate

The results of the comparison between the use of black seed honey combined with bee pollen and Sider honey along with bee pollen revealed no significant differences between the two treatments in all traits, despite the increase in the mean values in the case of the former treatment in relation to the MII trait and the decrease was observed in the mean values of the other traits compared to the mean values of the second experimental treatment (Table 5).

Comparison of the effect of adding black seed honey combined with bee pollen and Sider honey along with bee pollen on GSH content

As shown in Fig. 2, using black seed honey at a concentration of 5% combined with bee pollen at a concentration of 1 µg/mL as supplements in the maturation medium for culturing Najdi sheep oocytes in vitro was more favourable toward oocyte maturation than using Sider honey combined with bee pollen at the same concentrations (11.09 ± 0.29 vs. 10.09 ± 0.34), respectively.

Comparison of the effect of adding black seed honey combined with bee pollen and Sider honey along with bee pollen on the expression of candidate genes

As shown in Table 6, adding black seed honey combined with bee pollen to the in vitro maturation medium of Najdi sheep oocytes was better than using Sider honey combined with bee pollen because it resulted in significantly higher mean expression levels of all the examined genes in matured oocytes, except for the mean expression level of the apoptotic gene (BAX), for which the opposite result was obtained. BAX expression level was significantly higher in the treatment with Sider honey combined with bee pollen IVM medium supplement than in the former treatment (black seed honey combined with bee pollen) (7.61 ± 0.244 vs. 5.18 ± 0.707; P ≤ 0.05, respectively). Therefore, using the maturation medium supplemented with the combination of black seed honey and bee pollen leads to the best outcome concerning the maturation of Najdi sheep oocytes.

Discussion

Table 1: Primer sequences and functions of the studied candidate genes

Gene	Forward Primer	Accession Numbers	Function
β-Actin	Forward: AGGCCAACCGTGAGAAGATG	NM_001009784.1	Housekeeping gene; cell motility, structure, and integrity
	Reverse: AATCGCACGAGGCCAATCTC
GDF-9	Forward: AGCTGAAGTGGGACAACTGG	NM_001142888.2	Granulosa cell development
	Reverse: ACACAGGATGGTCTTGGCAC
BAX	Forward: TGCATCCACCAAGAAGCTGAG	XM_004015363.1	Apoptotic gene
	Reverse: AGGAAGTCCAATGTCCAGCC
Cyclin B	Forward: GAGGGGATCCAAACCTTTGTAGTGA	L48205	Cell cycle regulation
	Reverse: CTTCTTTACATGGGAGGTCTTTAAC
C-MOS	Forward: CTTGGACCTGAAGCCAGCGAACATT	X78318	Cell cycle regulation
	Reverse: GTTAGAGGCAGGCAGGGAGAGCCGC
IGF1	Forward: TGTGGAGACAGGGGCTTTTA	NC 022297.1	Cell development and differentiation
	Reverse: CAGCACTCATCCACGATTCC

Table 2: RT-PCR cycle conditions

Melt Curve Stage	PCR Stage	Hold Stage
95°C 15 s	95°C 15 s	50°C 2 min
60°C 1 min	60°C 1 min	95°C 10 min
95°C 15 s	70°C 30 min

Table 3: Effect of adding bee pollen (1 μg/mL) to the maturation medium supplemented with 5% honey on the maturation rate of Najdi sheep oocytes

Degenerated	MII	Anaphase	MI	GVBD	GV	Trait Treatment ^#
0.12±0.02^a	0.40±0.04^b	0.02±0.01^a	0.12±0.02^a	0.32±0.03^a	0.02±0.01^b	Black Seed Honey
0.06±0.02^b	0.49±0.04^a	0.00±0.00^b	0.10±0.02^b	0.27±0.03^b	0.08±0.02^a	Black Seed Honey + Bee pollen
0.23±0.03^a	0.44±0.04^b	0.02±0.01^a	0.05±0.02^b	0.22±0.03^a	0.05±0.02^b	Sider Honey
0.10±0.02^b	0.48±0.04^a	0.01±0.01^b	0.14±0.02^a	0.15±0.03^b	0.14±0.02^a	Sider Honey + Bee pollen

* Different letters (a, b) within each column are significantly different at P ≤ 0.05

* Values represent mean ± SE (standard error of mean)

# Comparisons between each type of bee honey and itself + bee pollen

GV: Germinal vesicle, GVBD: Germinal vesicle break down, MI: Metaphase I, MII: Metaphase II

Table 4: Effect of adding bee pollen (1 μg/mL) to the maturation medium supplemented with 5% honey on the expression of candidate genes

BAX	IGF-1	C-MOS	MPF	GDF-9	Trait Treatment ^#
5.97±0.27^a	8.32±0.07^b	9.19±0.08^b	9.28±0.43^b	7.85±0.30^b	Black Seed Honey
5.18±0.71^b	9.09±0.77^a	9.63±0.55^a	9.66±0.43^a	8.70±0.06^a	Black Seed Honey + Bee Pollen
2.85±0.02^b	6.16±0.75^b	6.73±0.66^b	5.80±0.90^b	4.62±0.57^b	Sider Honey
7.61±0.24^a	6.57±0.34^a	7.12±0.43^a	6.49±0.14^a	6.04±0.01^a	Sider Honey + Bee Pollen

* Different letters (a, b) within each column are significantly different at P ≤ 0.05

* Values represent mean ± SE (standard error of mean)

# Comparisons between each type of bee honey and itself + bee pollen

Table 5: Mean values ± SEM of nuclear stages when using black seed honey with bee pollen versus Sider honey with bee pollen

Trait Treatment	GV	GVBD	MI	Anaphase	MII	Degenerated
5% Black Seed Honey+ 1 µg Bee Pollen	0.08±0.019^a	0.27±0.031^b	0.10±0.021^ab	0.00±0.000^a	0.49±0.035^a	0.06±0.017^a
5% Sider Honey+ 1 µg Bee pollen	0.14±0.024^a	0.15±0.025^a	0.14±0.024^b	0.01±0.007^a	0.48±0.035^a	0.10±0.021^a

* Different letters (a, b) within each column are significantly different at P ≤ 0.05

* Values represent mean ± SE (standard error of mean)

GV: Germinal vesicle, GVBD: Germinal vesicle break down, MI: Metaphase I, MII: Metaphase II

Table 6: Mean values ± SEM of candidate gene expression when using black seed honey with bee pollen and Sider honey with bee pollen

Trait Treatment	GDF-9	MPF	C-MOS	IGF-1	BAX
5% Black Seed Honey+ 1 µg Bee Pollen	8.70±0.058^a	9.66±0.428^a	9.63±0.552^a	9.09±0.772^a	5.18±0.707^b
5% Sider Honey+ 1 µg Bee pollen	6.04±0.012^b	6.49±0.142^b	7.12±0.429^b	6.57±0.340^b	7.61±0.244^a

* Different letters (a, b) within each column are significantly different at P ≤ 0.05

* Values represent mean ± SE (standard error of mean)

To our knowledge, this study is the first investigation to demonstrate how the application of the combination of black seed honey and bee pollen as oocyte maturation supplements could markedly enhance Najdi sheep oocyte maturation and thus promote embryo production. Bee pollen and black seed honey consist of vitamins, proteins, antibiotics, antioxidants, enzymes, amino acids, sugars, fats, minerals, glycosides and flavonoids (Bogdanov 2004; Pawar et al. 2014; Veshkini et al. 2018).

An agricultural medium is the key determinant factor for IVP success (Greve et al. 1987; Rizos et al. 2002; Sutton et al. 2003). There are different methods to improve the process through the use of medium additives such as antioxidants, hormones, and vitamins, which enhance the nuclear and cytoplasmic oocyte maturation to increase the formation rate of the blastocyst (Shabankareh et al. 2012; Mishra et al. 2016; Dunning and Robker 2017).

According to the present study results, the addition of bee pollen combined with black seed honey to the maturation medium of sheep oocytes resulted in an increase in the number of oocytes that reached the MII stage in a shorter time compared with the addition of bee pollen combined with Sider supplement and honey alone supplement controls, thus indicating an improvement in the maturation rate. Furthermore, there was an increase in the GSH content of the matured oocytes. Hence, the elevation of the intracellular GSH levels and oocyte maturation rate correlated positively, and therefore, they could act as indicators for evaluating the efficiency of oocyte development (Eppig 1996; Luberda 2005; Veshkini et al. 2018). Moreover, the combination of black seed honey and bee pollen treatments led to the upregulation of the expression of oocyte developmental candidate genes, which was not observed with the black seed honey alone treatment.

Bee pollen and black seed honey are enriched with active ingredients and antioxidants, which might have yielded positive effects in improving the maturation rate and gene expression (Boselli et al. 2003; Kodai et al. 2007; Tamura et al. 2009; Valiollahpoor et al. 2016; Prazina and Mahmutovic 2017; Spulber et al. 2017). Consistent with the present study results, several previous studies have used various components and reported beneficial effects. For instance, addition of vitamins to the maturation medium of goat oocytes (Bormann et al. 2003) and sheep oocytes (Shabankareh et al. 2012) was found to be effective in improving oocyte maturation, as well as embryonic growth. In another study in which sugars were added through the use of fructose and glucose, each at 5.5 mmol concentration, to support the IVM of swine oocytes, it was observed that fructose supplement is better than glucose in the in vitro production of swine embryos (Wongsrikeao et al. 2006). Furthermore, the addition of quercetin (QT), a component of bee pollen with antioxidant properties, at a low concentration (1.0 μg/mL) to the maturation medium of swine oocytes resulted in an increase in the number of oocytes that reached the MII stage at a higher rate and a decrease in ROS levels (Kang et al. 2016).

The results of the present study are also consistent with those reported by Veshkini et al. (2018), who used royal jelly, one of black seed honey products, at a concentration of 5 mg/mL as an IVM medium supplement and observed an improvement in the maturation rate of goat oocytes, leading to an enhancement in the GSH content and a reduction in the expression of apoptosis-inducing genes. In addition, several studies have demonstrated similar results using royal jelly in culture media (Ali et al. 2003; Dey et al. 2012; Choi et al. 2013; Do et al. 2015; Fakruzzaman et al. 2015; Mazangi et al. 2015; Mishra et al. 2016; Valiollahpoor et al. 2016).

ROS are produced by oocytes and embryos through metabolism, which stimulate granulosa apoptosis, leading to a reduction in oocyte maturation and embryonic development (Khazaei and Aghaz 2017). Therefore, oxidative stress certainly has a negative impact on in vitro oocyte maturation and subsequent embryonic development. However, while present in vivo, the oviductal and follicular fluids contain natural antioxidants that neutralize their effects, thereby protecting them from oxidative stress (Wang et al. 2002; Gupta et al. 2010).

Similarly, previous studies have demonstrated that supplementing IVM media with antioxidants such resveratrol (Kwak et al. 2012), melatonin (Do et al. 2015), and l-carnitine (Mishra et al. 2016) led to an improvement in the maturation rate and embryonic development, an increase in the GSH content, and a reduction in ROS levels. Moreover, cytoplasmic maturation was found to be improved through the alleviation of oxidative stress during IVM (Khazaei and Aghaz 2017).

The results of the present study also indicated an improvement in the oocyte GSH content due to the supplementation of black seed honey to the IVM medium, which thereby protected the oocytes from ROS due to the antioxidant effect and enhanced the expression of candidate genes; this finding was consistent with other studies that have used some of the components of honey and reported similar results (Ali et al. 2003; Dey et al. 2012; Kwak et al. 2012; Choi et al. 2013; Do et al. 2015; Fakruzzaman et al. 2015; Mazangi et al. 2015; Valiollahpoor et al. 2016; Veshkini et al. 2018).

Conclusion

The addition of a combination of 1.0 µg/mL bee pollen and 5% black seed honey as supplements to the maturation medium of Naidi sheep oocytes had a positive effect by enhancing their in vitro maturation rate, GSH content that protects against free radical damage, and expression of oocyte developmental candidate genes. These beneficial effects are attributable to the enriched components of bee pollen and black seed honey, consistent with previous investigations.

Acknowledgment

Research Supporting Project number (RSP-2020/106), King Saud University, Riyadh, Saudi Arabia.

Author Contributions

Conceptualization, methodology and investigation by IMK; formal analysis by IAHB; Original draft written by IMK and IAHB; write up improvement and editing by IAHB, RAA and RAA; funding acquisition by IAHB; supervision by IAHB and RAA

References

Aghaz F, H Hajarian, HK Shabankareh, A Abdolmohammadi (2015). Effect of sericin supplementation in maturation medium on cumulus cell expansion, oocyte nuclear maturation, and subsequent embryo development in Sanjabi ewes during the breeding season. Theriogenology 84:1631‒1635

Ali AA, JF Bilodeau, MA Sirard (2003). Antioxidant requirements for bovine oocytes varies during in vitro maturation, fertilization and development. Theriogenology 59:939‒949

Amiri MV, H Deldar, Z Ansari Pirsaraei (2016). Impact of supplementary royal jelly on in vitro maturation of sheep oocytes: Genes involved in apoptosis and embryonic development. Syst Biol Reprod Med 62:31‒38

Barakat IAH, AM Kaabi, RA Alajmi (2020). The role of honeybee pollen as a natural source of antioxidants in the in vitro maturation medium of sheep oocytes and its effect on gene expression. Environ Sci Pollut Res Intl 27:31350‒31356

Barakat IAH, RA Alajmi, KMA Zoheir, ML Salem, AR Al-Hemidiy (2018). Gene expression and maturation evaluation of sheep oocytes cultured in medium supplemented with natural antioxidant source. S Afr J Anim Sci 48:261‒270

Barakat IAH, AR Al-Himaidi, AM Rady (2014). Antioxidant effect of green tea leaves extract on in vitro production of sheep embryos. Pak J Zool 46:167‒175

Barakat IAH, AR Al-Himaidi (2013). Effects of fenugreek seed extract on in vitro maturation and subsequent development of sheep oocytes. Pak J Zool 45:1679‒1686

Biesalski HK, LO Dragsted, I Elmadfa, R Grossklaus, M Müller, D Schrenk, P Walter, P Weber (2009). Bioactive compounds: Definition and assessment of activity. Nutrition 25:1202‒1205

Bogdanov S (2004). Quality and standards of pollen and beeswax. Apiacta 38:334‒341

Bormann CL, EM Ongeri, RL Krisher (2003). The effect of vitamins during maturation of caprine oocytes on subsequent developmental potential in vitro. Theriogenology 59:1373‒1380

Boselli E, MF Caboni, AG Sabatini, GL Marcazzan, G Lercker (2003). Determination and changes of free amino acids in royal jelly during storage. Apidologie 34:129‒137

Choi BH, JI Bang, JI Jin, SS Kim, HT Jo, GK Deb, N Ghanem, KW Cho, IK Kong (2013). Coculturing cumulus oocyte complexes with denuded oocytes alters zona pellucida ultrastructure in in vitro matured bovine oocytes. Theriogenology 80:1117‒1123

Dey SR, GK Deb, AN Ha, JI Lee, JI Bang, KL Lee, IK Kong (2012). Coculturing denuded oocytes during the in vitro maturation of bovine cumulus oocyte complexes exerts a synergistic effect on embryo development. Theriogenology 77:1064‒1077

Do LT, Y Shibata, M Taniguchi, M Nii, TV Nguyen, F Tanihara, M Takagi, T Otoi (2015). Melatonin supplementation during in vitro maturation and development supports the development of porcine embryos. Reprod Domest Anim 50:1054‒1058

Dunning KR, RL Robker (2017). The role of L-carnitine during oocyte in vitro maturation: Essential co-factor? Anim Reprod 14:469‒475

Duzguner INB, Y Tasci, GS Caglar, B Dilbaz, S Demirtas, I Kaplanoglu, S Duzguner (2014). Follicular fluid total antioxidant capacity and ischemia modified albumin levels in polycystic ovary syndrome. Fert Steril 102:278–278

El-Aziz AHA, UE Mahrous, SZ Kamel, AA Sabek (2016). Factors influencing in vitro production of bovine embryos: A review. Asian J Anim Vet Adv 11:737‒756

Eppig JJ (1996). Coordination of nuclear and cytoplasmic oocyte maturation in eutherian mammals. Reprod Fert Dev 8:485‒489

Escriche I, M Kadar, M Juan-Borrás, E Domenech (2014). Suitability of antioxidant capacity, flavonoids and phenolic acids for floral authentication of honey. Impact of industrial thermal treatment. Food Chem 142:135‒143

Fakruzzaman M, N Ghanem, JI Bang, AN Ha, KL Lee, SH Sohn, Z Wang, DS Lee, IK Kong (2015). Effect of peroxiredoxin II on the quality and mitochondrial activity of pre-implantation bovine embryos. Anim Reprod Sci 159:172‒183

Gannabathula S, GW Krissansen, L Bisson-Rowe, M Skinner, G Steinhorn, R Schlothauer (2017). Correlation of the immunostimulatory activities of honeys with their contents of identified bio-actives. Food Chem 221:39‒46

Gomes S, LG Dias, LL Moreira, P Rodrigues, L Estevinho (2010). Physicochemical, microbiological and antimicrobial properties of commercial honeys from Portugal. Food Chem Toxicol 48:544‒548

Greve T, KP Xu, H Callesen, P Hyttel (1987). In vivo development of in vitro fertilized bovine oocytes matured in vivo versus in vitro. J In Vitro Fert Embryo Transf 4:281‒285

Guiné RP (2015). Bee pollen: Chemical composition and potential beneficial effects on health. Curr Nutr Food Sci 11:301‒308

Gupta S, L Sekhon, Y Kim, A Agarwal (2010). The role of oxidative stress and antioxidants in assisted reproduction. Women Health Rev 6:227‒238

Jagannathan L, S Cuddapah, M Costa (2016). Oxidative stress under ambient and physiological oxygen tension in tissue culture. Curr Pharmacol Rep 2:64‒72

Kaabi AM, IAH Barakat, RA Alajmi, MM Abdel-Daim (2020). Use of black seed (Nigella sativa) honey bee to improve sheep oocyte maturation medium. Environ Sci Pollut Res Intl 27:33872‒33881

Kang JT, JH Moon, JY Choi, SJ Park, SJ Kim, IM Saadeldin, BC Lee (2016). Effect of antioxidant flavonoids (quercetin and taxifolin) on in vitro maturation of porcine oocytes. Asian Aust J Anim 29:352‒358

Khazaei M, F Aghaz (2017). Reactive oxygen species generation and use of antioxidants during in vitro maturation of oocytes. Intl J Fert Steril 11:63‒70

Kharche SD, HS Birade (2013). Parthenogenesis and activation of mammalian oocytes for in vitro embryo production: A review. Adv Biosci Biotechnol 4:170‒182

Kodai T, K Umebayashi, T Nakatani, K Ishiyama, N Noda (2007). Compositions of royal jelly II. Organic acid glycosides and sterols of the royal jelly of honeybees (Apis mellifera). Chem Pharm Bull 55:1528‒1531

Kwak SS, SA Cheong, Y Jeon, E Lee, KC Choi, EB Jeung, SH Hyun (2012). The effects of resveratrol on porcine oocyte in vitro maturation and subsequent embryonic development after parthenogenetic activation and in vitro fertilization. Theriogenology 78:86‒101

Legge M, MH Sellens (1991). Free radical scavengers ameliorate the 2-cell block in mouse embryo culture. Hum Reprod 6:867‒871

Liu S, W Zhu, X Bai, T You, J Yan (2019). Effect of ultrasonic energy density on moisture transfer during ultrasound enhanced vacuum drying of honey. J Food Measure Charact 13:559‒570

Liu Z, RH Foote (1995). Effects of amino acids on the development of in-vitro matured/in-vitro fertilization bovine embryos in a simple protein-free medium. Hum Reprod 10:2985‒2991

Livak KJ, TD Schmittgen (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method. Methods 25:402‒408

Luberda Z (2005). The role of glutathione in mammalian gametes. Reprod Biol 5:5‒17

Manjunatha BM, M Devaraj, PS Gupta, JP Ravindra, S Nandi (2009). Effect of taurine and melatonin in the culture medium on buffalo in vitro embryo development. Reprod Domest Anim 44:12‒16

Mazangi HR, H Deldar, NE Kashan, A Mohammadi-Sangcheshmeh (2015). 305 Royal jelly treatment during oocyte maturation improves in vitro meiotic competence of goat oocytes by influencing intracellular glutathione synthesis and apoptosis gene expression. Reprod Fert Dev 27:241‒241

Mishra A, IJ Reddy, PS Gupta, S Mondal (2016). l‐carnitine mediated reduction in oxidative stress and alteration in transcript level of antioxidant enzymes in sheep embryos produced in vitro. Reprod Domest Anim 51:311‒321

Molan PC (1999). The role of honey in the management of wounds. J Wound Care 8:415‒418

Natsuyama S, Y Noda, M Yamashita, Y Nagahama, T Mori (1993). Superoxide dismutase and thioredoxin restore defective p34cdc2 kinase activation in mouse two-cell block. Biochim Biophys Acta Mol Cell Res 1176:90‒94

Ozawa M, T Nagai, M Fahrudin, NWK Karja, H Kaneko, J Noguchi, K Ohnuma, K Kikuchi (2006). Addition of glutathione or thioredoxin to culture medium reduces intracellular redox status of porcine IVM/IVF embryos, resulting in improved development to the blastocyst stage. Mol Reprod Dev 73:998‒1007

Öztürkler Y, S Yildiz, Ö Güngör, ŞM Pancarci, C Kacar, UÇ Ari (2010). The effects of L-ergothioneine and L-ascorbic acid on the in vitro maturation (IVM) and embryonic development (IVC) of sheep oocytes. Development 1:5‒14

Paramás AMG, JAG Bárez, CC Marcos, RJ García-Villanova, JS Sánchez (2006). HPLC-fluorimetric method for analysis of amino acids in products of the hive (honey and bee-pollen). Food Chem 95:148‒156

Pasupuleti VR, L Sammugam, N Ramesh, SH Gan (2017). Honey, propolis, and royal jelly: A comprehensive review of their biological actions and health benefits. Oxid Med Cell Longev 2017; Article 1259510

Pawar R, V Wagh, D Panaskar (2014). Effect of altered environmental conditions on nutritional quality of bee pollen: A contemporary overview. J Environ Sci Comp Sci Eng Technol 3:1814‒1821

Prazina N, O Mahmutovic (2017). Analysis of biochemical composition of honey samples from bosnia and Herzegovina. Nat Soc Sci 5:73‒78

Prentice-Biensch JR, J Singh, B Alfoteisy, M Anzar (2012). A simple and high-throughput method to assess maturation status of bovine oocytes: Comparison of anti-lamin A/C-DAPI with an aceto-orcein staining technique. Theriogenology 78:1633‒1638

Premkumar KV, SK Chaube (2016). Increased level of reactive oxygen species persuades postovulatory aging-mediated spontaneous egg activation in rat eggs cultured in vitro. In Vitro Cell Dev Biol Anim 52:576‒588

Premkumar KV, SK Chaube (2014). RyR channel-mediated increase of cytosolic free calcium level signals cyclin B1 degradation during abortive spontaneous egg activation in rat. In Vitro Cell Dev Biol-Anim 50:640‒647

Rizos D, F Ward, P Duffy, MP Boland, P Lonergan (2002). Consequences of bovine oocyte maturation, fertilization or early embryo development in vitro versus in vivo: Implications for blastocyst yield and blastocyst quality. Mol Reprod Dev 61:234‒248

Rodrigues-Cunha MC, LG Mesquita, F Bressan, MDD Collado, JC Balieiro, KR Schwarz, FCD Castro, OY Watanabe, YF Watanabe, LDA Coelho, CL Leal (2016). Effects of melatonin during IVM in defined medium on oocyte meiosis, oxidative stress, and subsequent embryo development. Theriogenology 86:1685‒1694

Sadowska M, H Gogolewska, N Pawelec, A Sentkowska, B Krasnodębska-Ostręga (2019). Comparison of the contents of selected elements and pesticides in honey bees with regard to their habitat. Environ Sci Pollut Res Intl 26:371‒380

Sasaki H, T Hamatani, S Kamijo, M Iwai, M Kobanawa, S Ogawa, K Miyado, M Tanaka (2019). Impact of oxidative stress on age-associated decline in oocyte developmental competence. Front Endocrinol 10; Article 811

Shabankareh HK, F Kafilzadeh, L Soltani (2012). Treatment of ovine oocytes with certain water-soluble vitamins during in vitro maturation (IVM). Small Rumin Res 104:139‒145

Sime D, M Atlabachew, M Abshiro, T Zewde (2015). Total phenols and antioxidant activities of natural honeys and propolis collected from different geographical regions of Ethiopia. Bull Chem Soc Ethiop 29:163‒172

Sowa P, M Tarapatskyy, C Puchalski, W Jarecki, M Dżugan (2019). A novel honey-based product enriched with coumarin from melilotus flowers. J Food Measure Charact 13:1748‒1754

Spulber R, MG Vladu, O Popa, N Băbeanu (2017). Phenolic content and potential inhibitory activity of Romanian bee pollen on different plant pathogenic strains. Sci Bull Ser F Biotechnol 21:104‒108

Sutton ML, RB Gilchrist, JG Thompson (2003). Effects of in-vivo and in-vitro environments on the metabolism of the cumulus–oocyte complex and its influence on oocyte developmental capacity. Hum Reprod Update 9:35‒48

Suzuki C, K Yoshioka, M Sakatani, M Takahashi (2007). Glutamine and hypotaurine improves intracellular oxidative status and in vitro development of porcine preimplantation embryos. Zygote 15:317‒324

Roulston TH, JH Cane (2000). Pollen nutritional content and digestibility for animals. Plant Syst Evol 222:187‒209

Tamura S, T Kono, C Harada, K Yamaguchi, T Moriyama (2009). Estimation and characterisation of major royal jelly proteins obtained from the honeybee Apis merifera. Food Chem 114:1491‒1497

Taormina PJ, BA Niemira, LR Beuchat (2001). Inhibitory activity of honey against foodborne pathogens as influenced by the presence of hydrogen peroxide and level of antioxidant power. Intl J Food Microbiol 69:217‒225

Tonks AJ, RA Cooper, KP Jones, S Blair, J Parton, A Tonks (2003). Honey stimulates inflammatory cytokine production from monocytes. Cytokine 21:242‒247

Veshkini A, A Mohammadi-Sangcheshmeh, N Ghanem, AH Abazari-kia, E Mottaghi, R Kamaledini, H Deldar, I Ozturk, EL Gastal (2018). Oocyte maturation with royal jelly increases embryo development and reduces apoptosis in goats. Anim Reprod 15:124‒134

Wang X, T Falcone, M Attaran, JM Goldberg, A Agarwal, RK Sharma (2002). Vitamin C and vitamin E supplementation reduce oxidative stress–induced embryo toxicity and improve the blastocyst development rate. Fert Steril 78:1272‒1277

Wongsrikeao P, T Otoi, M Taniguchi, NWK Karja, B Agung, M Nii, T Nagai (2006). Effects of hexoses on in vitro oocyte maturation and embryo development in pigs. Theriogenology 65:332‒343

You J, J Kim, J Lim, E Lee (2010). Anthocyanin stimulates in vitro development of cloned pig embryos by increasing the intracellular glutathione level and inhibiting reactive oxygen species. Theriogenology 74:777‒785

Yusof N, AH Ainul Hafiza, RM Zohdi, MZA Bakar (2007). Development of honey hydrogel dressing for enhanced wound healing. Radiat Phys Chem 76:1767‒1770